| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.044521 |
| Chromosome: | chromosome 12 |
| Location: | 9211830 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542950 | CGL137,NUP54 | Nucleoporin 54; (1 of 1) K14308 - nuclear pore complex protein Nup54 (NUP54, NUP57) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGTTGCTCCGAAGCCTTGGGTTGGCGCGGTGCCAAACAGGGACGGA |
| Internal bar code: | CTTTTTTTTGGGTTAGGCTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2726 |
| LEAP-Seq percent confirming: | 82.3529 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTGGGGGATTGGCTAAGC |
| Suggested primer 2: | GGCTGAGAGGGAAAACGGAA |