| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045333 |
| Chromosome: | chromosome 17 |
| Location: | 3782793 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g726850 | (1 of 3) K11089 - 60 kDa SS-A/Ro ribonucleoprotein (TROVE2, SSA2); Similar to Sjogren Syndrome Antigen A2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAGCGGGTGTACGCTAGCCTCTGCCCATCAGTCCCATCATCCCAGTTG |
| Internal bar code: | AGCTTATTGATCCCACACGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2300 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACCAACAACCTTGCAGC |
| Suggested primer 2: | CCCACTCCGAGTCTGAATCG |