| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045970 |
| Chromosome: | chromosome 15 |
| Location: | 3007730 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g643503 | HKR5,HKR6,HKR56,COP9,COP10 | (1 of 1) IPR000104//IPR001054//IPR001789//IPR003594//IPR003661//IPR004358//IPR005467//IPR011006//IPR029730//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Signal transduction response regulator, receiver domain // Histidine kinase-like ATPase, C-terminal domain // Signal transduction histidine kinase, dimerisation/phosphoacceptor domain // Signal transduction histidine kinase-related protein, C-terminal // Histidine kinase domain // CheY-like superfamily // Archaeal/bacterial/fungal rhodopsin-like // Nucleotide cyclase; Histidine kinase rhodopsin 5/6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACCCAATGCAAAATTGGCGTGGGTCGGGTGGGGTTATACTCTGGTGC |
| Internal bar code: | GCAATGTTTGGCCAAGGGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1186 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTATCAGGGCCCAACTTG |
| Suggested primer 2: | CATTGGAAGAGCGCGATGTG |