Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.046524 |
Chromosome: | chromosome 12 |
Location: | 6984243 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560900 | CPLD35,AOF7 | Flavin-containing amine oxidase. Conserved in plant lineage and Diatoms; (1 of 2) 1.3.5.5 - 15-cis-phytoene desaturase / Plant-type phytoene desaturase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCCCACCTGTCTACCCCACCCGGTGTTCAACCCTTCCTGCACCCTCA |
Internal bar code: | ATGAGTTTACTTGGTTTCTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3265 |
LEAP-Seq percent confirming: | 82.1429 |
LEAP-Seq n confirming: | 92 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTACCATAAGGAGGCCGGT |
Suggested primer 2: | ACCTGCAACCTGTACTTCCG |