| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.046712 |
| Chromosome: | chromosome 6 |
| Location: | 8147099 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g305900 | CPLD22,UAA4 | Putative GDP-fucose transporter, conserved in the plant lineage and diatoms; (1 of 3) PTHR11132//PTHR11132:SF64 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTGTGTGTGTAACAACGGTTTACAGTTGTTTATCAGATCACGTGA |
| Internal bar code: | GAGGGCGCGCGTCGTTAGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1016 |
| LEAP-Seq percent confirming: | 63.1579 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAATGCATAGTGGCCAGCT |
| Suggested primer 2: | ATCAACCTGCCGTTCGAACT |