Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.047976 |
Chromosome: | chromosome 4 |
Location: | 156549 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g216850 | TUA2 | (1 of 2) K07374 - tubulin alpha (TUBA); Alpha tubulin 2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCACCGTGGTGGATGAGGTCCGCACCGGCACCTACCGCCAGCTGTTC |
Internal bar code: | GCTAGTATTCTAATTTACTAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2836 |
LEAP-Seq percent confirming: | 37.931 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGACAGCACCGAGTTGTA |
Suggested primer 2: | GATTACGCTCACGCAAGCTG |