| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.048109 |
| Chromosome: | chromosome 3 |
| Location: | 4918147 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g178900 | PRD1 | (1 of 43) IPR011989 - Armadillo-like helical; putative meiotic recombination protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGGCGCTGAGGAGCGCGCAATCGGCTGTAGCAGCCGCGGCGGCGGCGG |
| Internal bar code: | AAGTCGTACGCGTGCGCATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 871 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTAGCAGTGGCAGGAACA |
| Suggested primer 2: | CCGCATGATAGCATAGGCCA |