| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048744 |
| Chromosome: | plastome |
| Location: | 67365 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802292 | ccsA,ChreCp028,2717027,ycf5 | (1 of 1) PTHR30071//PTHR30071:SF8 - HEME EXPORTER PROTEIN C // CYTOCHROME C BIOGENESIS PROTEIN CCSA; cytochrome c biogenesis protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATACAGGGTTAATCGGTAAATAAGTTGTAGAAACATTAATATTGTTTGC |
| Internal bar code: | GTACGGCTCACCGTTAGCTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 272 |
| LEAP-Seq percent confirming: | 48.9796 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTCTTGTGCGAACAAGG |
| Suggested primer 2: | TTCATTAGCCCACACAGCCC |