| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.050070 |
| Chromosome: | chromosome 12 |
| Location: | 8163134 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g552050 | (1 of 11) PF13229 - Right handed beta helix region (Beta_helix) | CDS | |
| lncRNA_TCONS_00119430 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGGGGGCCGTTGCGGCCCCGGGAGGGGGCCCGGCCATACGCGGGCA |
| Internal bar code: | CTCACAGATAATTATTGTTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 981 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATATACCGGGCGGGAGGAG |
| Suggested primer 2: | GGAACGAGCCCATTTGCATC |