Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.050349 |
Chromosome: | chromosome 5 |
Location: | 2464483 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239000 | (1 of 1) IPR006626//IPR011050//IPR011989//IPR012334 - Parallel beta-helix repeat // Pectin lyase fold/virulence factor // Armadillo-like helical // Pectin lyase fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCCTGCTGGAGCGCAACTGGGTGTCCGCGGCCCAACGCGGCTTCGAGG |
Internal bar code: | CGATAATTAGACTCACGTAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 640 |
LEAP-Seq percent confirming: | 86.3636 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCACTGTGTTGTGCCTTGA |
Suggested primer 2: | AGTGATGTGTGATGGGGCTG |