| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050983 |
| Chromosome: | chromosome 12 |
| Location: | 3154602 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g500500 | SMT1,SMT2,STM1 | (1 of 1) 2.1.1.143 - 24-methylenesterol C-methyltransferase / SMT(2); Sterol-C24-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGTGCGCGCCGGGACAAGCACAAGAGGGGGCAAGGCGCGCTGGAGG |
| Internal bar code: | GTTATAATTTCACGAGCACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2157 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGGACGTGTTCTACAGC |
| Suggested primer 2: | CTTTCTTCCCCATCCACCCC |