Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.051014 |
Chromosome: | chromosome 12 |
Location: | 3145948 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g500600 | VMA21 | (1 of 1) PF09446 - VMA21-like domain (VMA21); vacuolar ATPase assembly factor | gene_edge/mRNA_edge/CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTAATCGTTCTTCTTTGCCTCCACCTTTGCCGTATCGTCCGTGGTCA |
Internal bar code: | GTCGGAGAGGACTCTCCTACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1388 |
LEAP-Seq percent confirming: | 64.2857 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATTTTGTTGGCGGTGAGGC |
Suggested primer 2: | GCAACCCGTAACCAACCAAC |