Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.051701 |
Chromosome: | chromosome 1 |
Location: | 4193997 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g028200 | DBP2,HEL6 | (1 of 1) PTHR24031:SF219 - ATP-DEPENDENT RNA HELICASE DDX5-RELATED; DEAD-box RNA helicase | CDS |
Cre01.g028250 | GEA1 | Putative lysophospholipase, glycerol-ester acylhydrolase; (1 of 1) 3.1.1.23//3.1.1.3 - Acylglycerol lipase / Monoacylglycerol lipase // Triacylglycerol lipase / Triglyceride lipase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAGCCTCCGCCTCCGCCTCCACCGCCGTGACCTCCACTGTCCCATCGC |
Internal bar code: | CGTGAGGGGGTGGGTGTACGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1763 |
LEAP-Seq percent confirming: | 80.9524 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTACAGTTCGCATCACCGC |
Suggested primer 2: | TCCTCAAACGTCTTCACCGG |