| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.051815 |
| Chromosome: | chromosome 2 |
| Location: | 4767311 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108700 | (1 of 4) 2.7.10.2//2.7.11.1//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Dual-specificity kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTGTGCTCCAGAGACGGCGGCACTCCCGCAAGTGCCGCCTGCGGATG |
| Internal bar code: | ATTCCTTGGCTAGTCGCCTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6090 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCGCGACTACTTTGTGG |
| Suggested primer 2: | TTGTCCAGCATTTGTGCACG |