| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.052172 |
| Chromosome: | chromosome 13 |
| Location: | 4619794 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g603700 | DII4,NSG4,ACT1,IDA5 | Actin, flagellar inner arm dynein subunit; (1 of 1) K10355 - actin, other eukaryote (ACTF) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACTGCGCCTCGTCGCCAACGTACGAGTCCTGCAGAGTCCAAAGAAGC |
| Internal bar code: | TAACTCTACAAAACCGGATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3612 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGTGGGGACTTCCATTTA |
| Suggested primer 2: | CTCGACCTCTCTCACCTGGA |