| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053595 |
| Chromosome: | chromosome 2 |
| Location: | 825778 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078750 | PUS3 | RNA pseudouridine synthase; (1 of 1) K15452 - tRNA pseudouridine synthase 2 [EC:5.4.99.-] (PUS2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACCGTCCCGAATTCCCGCCAACGTGCTGACGTCCGTCGCCCCTACCC |
| Internal bar code: | GGCAGGGGAAAACCCGCGCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 1.19048 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTACAACAGGGACGTCGG |
| Suggested primer 2: | CACGCACACACTTCACACAG |