Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.054186 |
Chromosome: | chromosome 4 |
Location: | 3130779 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g225900 | VAM2,VAMP72,VAMP2 | Endosomal R-SNARE protein, Vamp7/Nyv1-family (R.III); (1 of 1) PTHR21136//PTHR21136:SF73 - SNARE PROTEINS // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTTGGTATGAAAAAAGGCAGGGCAGGGTGCGGTGGCCTCTAGCGGCC |
Internal bar code: | TTCCTAAGTCCAGGGAAACACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2693 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACCCAAACCGTCCCTCAC |
Suggested primer 2: | CTGCTCGACTATGCCGCTAA |