| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.054421 |
| Chromosome: | chromosome 11 |
| Location: | 3785244 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479300 | SRH20 | SNF2-related DNA/RNA helicase; (1 of 1) K15083 - DNA repair protein RAD16 (RAD16) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGAGGGGTAGATAGGAAGCGAGTGGAGCGGGTGGTTGCATTTGCTTG |
| Internal bar code: | GGTATGAAGCTCCGTTAGTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 735 |
| LEAP-Seq percent confirming: | 68.75 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGTGCAACATGTTTCGG |
| Suggested primer 2: | CTGGTGTGCTGTTGTGTTGG |