Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.054445 |
Chromosome: | chromosome 13 |
Location: | 2252253 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g578451 | TSL1 | (1 of 2) 6.1.1.4 - Leucine--tRNA ligase / Leucyl-tRNA synthetase; Leucyl-tRNA synthetase | 5'UTR |
Cre13.g578501 | (1 of 1) IPR009060//IPR015940//IPR026741//IPR026937//IPR027417 - UBA-like // Ubiquitin-associated domain // Protein strawberry notch // Strawberry notch, helicase C domain // P-loop containing nucleoside triphosphate hydrolase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGCACATGCTCATCTGGGCAACATAAATTATGCACTGTCATTTAAAG |
Internal bar code: | CCGTCAATATCTTATAGTTACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 824 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCCTCTTCTTTCCTTCCC |
Suggested primer 2: | ACTTGGCCTCAATCTCCGTG |