| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.054460 |
| Chromosome: | chromosome 17 |
| Location: | 3872795 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g727600 | (1 of 1) PF06650//PF12624//PF16908//PF16909 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // N-terminal region of Chorein or VPS13 (Chorein_N) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Vacuolar-sorting-associated 13 protein C-terminal (VPS13_C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGACGCAGGAGTCCGAGGGCGACAGGTCACATGCCTTAAAACCCGGTC |
| Internal bar code: | CGAGTAGCATTAAGCTCTGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 41.6667 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCTCTCAAGCTCAACCG |
| Suggested primer 2: | ACGTGGTGCATAACGGACTT |