| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.055097 |
| Chromosome: | chromosome 11 |
| Location: | 1430785 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g469600 | HDA9 | (1 of 1) IPR000286//IPR002110//IPR020683//IPR023801 - Histone deacetylase superfamily // Ankyrin repeat // Ankyrin repeat-containing domain // Histone deacetylase domain; RPD3/HDA1 type histone deacetylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTGGTGTTGATGTTGTTGTTGAAAAGCCCCGCGTGTGCGTGCCTAC |
| Internal bar code: | AAGACTGAACCTCTAACGAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 969 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAACAATGTGGCGGTGG |
| Suggested primer 2: | GATGAGTTGGGGATAGCCGG |