Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.056216 |
Chromosome: | chromosome 12 |
Location: | 5082383 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g525650 | SUFS,SUFS1,CSD4 | (1 of 1) K11717 - cysteine desulfurase / selenocysteine lyase (sufS); Group II cysteine desulfurase | outside_mRNA |
Cre12.g525700 | HCS1 | Cytochrome c heme lyase; (1 of 2) 4.4.1.17 - Holocytochrome-c synthase / Cytochrome c synthase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAGCTTGCAACGTGGGCACAGCGAGCCGAAACAGAGAAATCCACGCG |
Internal bar code: | GTGGCGGCTGGAGCAACGCTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 921 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCAGGTAGACCAGGGGAT |
Suggested primer 2: | CCAACGTCTACACCAGCCTT |