Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.056355 |
Chromosome: | chromosome 2 |
Location: | 6801049 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g388097 | TOC80,OEP80 | Putative outer membrane chloroplast protein; (1 of 2) K07277 - outer membrane protein insertion porin family (SAM50, TOB55, bamA) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTACCTCATAACCCCAACGCCACCTCACCCAAGCCATCTGCGGCATAC |
Internal bar code: | TATACGTCTCGCCTTAATGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2197 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTCTATTGCAGCCCCAAA |
Suggested primer 2: | TGCACAGGTACGTCTTGGTC |