Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.056895 |
Chromosome: | chromosome 2 |
Location: | 137808 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g074150 | HKR1,COP5 | (1 of 1) IPR001054//IPR001425//IPR001789//IPR003594//IPR003661//IPR004358//IPR005467//IPR011006//IPR013761//IPR029730//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // Archaeal/bacterial/fungal rhodopsin // Signal transduction response regulator, receiver domain // Histidine kinase-like ATPase, C-terminal domain // Signal transduction histidine kinase, dimerisation/phosphoacceptor domain // Signal transduction histidine kinase-related protein, C-terminal // Histidine kinase domain // CheY-like superfamily // Sterile alpha motif/pointed domain // Archaeal/bacterial/fungal rhodopsin-like // Nucleotide cyclase; Histidine kinase rhodopsin 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCACCTGGTGCCGGGGCTGGATGCGGCTGACAGGCGGCTCTACGGCAC |
Internal bar code: | CGCAGGGACAGTTTGTGTGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1397 |
LEAP-Seq percent confirming: | 7.5 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGAGTGTGTGTGTGTGT |
Suggested primer 2: | AGACATTGCACAAACGTGGC |