| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.057405 |
| Chromosome: | chromosome 3 |
| Location: | 1452911 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151250 | LANC1,LAN1 | (1 of 1) PF05147 - Lanthionine synthetase C-like protein (LANC_like); LanC lantibiotic synthetase component C-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTGTCAATCGTTTCGGTGTTTGGCGAGAGTACCCAGACCCTTCACGGA |
| Internal bar code: | GTTGGTTTAATAGATAAGCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1231 |
| LEAP-Seq percent confirming: | 89.6552 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGCAGGGTTTCGATATCG |
| Suggested primer 2: | AAGACACACAGCTTACCGGG |