Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.057638 |
Chromosome: | chromosome 16 |
Location: | 2682042 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g661650 | (1 of 6) IPR001471//IPR016177 - AP2/ERF domain // DNA-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCACCCGACAGGCACCGGCAACAACCTACCGCTCAGCACAGCACACAC |
Internal bar code: | GTACCGAATAAGTAATCCTGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2012 |
LEAP-Seq percent confirming: | 97.7273 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAAGACTTGGGGCACTGAT |
Suggested primer 2: | ACACCTTGCCATGCTATGCT |