Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.058640 |
Chromosome: | chromosome 1 |
Location: | 3852831 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g025300 | RAD51B | (1 of 1) K10869 - RAD51-like protein 1 (RAD51L1, RAD51B); DNA recombination protein | 5'UTR |
Cre01.g025350 | FAP235 | (1 of 3) PF03703 - Bacterial PH domain (bPH_2); Flagellar Associated Protein 235 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTGCGACAACCCGAAACCTGTCTACCTGCGCCTCTACCAGATACGCG |
Internal bar code: | AAATTCGGGCTCGACATTGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4535 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTATGTACGGCACCGGAG |
Suggested primer 2: | ACATGCCGACATATTCCGCT |