| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.058760 |
| Chromosome: | chromosome 3 |
| Location: | 3527000 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g167550 | POC3,CEP290 | Proteome of centriole protein 3; (1 of 1) K16533 - centrosomal protein CEP290 (CEP290, NPHP6) | 5'UTR |
| Cre03.g167600 | CaM-IP3,FAP61 | (1 of 1) PF16092 - Domain of unknown function (DUF4821) (DUF4821); Flagellar Associated Protein 61 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATGTGTTATGACGTAAATTGAAAATAAGATAACAGTCGTTAGTGACG |
| Internal bar code: | TTAGTCTTGTGGTGATTTAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2782 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCGATATCTCACAGGCT |
| Suggested primer 2: | CGGAACTCATAGTCGCCCTC |