| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058772 |
| Chromosome: | chromosome 9 |
| Location: | 2065320 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396400 | UBQ2 | Bi-ubiquitin; (1 of 1) K12158 - ubiquitin-like protein Nedd8 (NEDD8) | 5'UTR |
| Cre09.g396450 | APT3,GOX15 | Acid phosphatase; (1 of 9) 3.1.3.2 - Acid phosphatase / Phosphomonoesterase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCAACCCTTGTTGGACTTGGTGACTAGCAAAGATGCAGATTTTCGTC |
| Internal bar code: | TGTATTTGACCCGCAGGGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 626 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCAATCCCCTTCCCCTC |
| Suggested primer 2: | TGTGACTACGCCAGCAAGAG |