Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.059493 |
Chromosome: | chromosome 6 |
Location: | 2718098 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g270850 | SRH12 | (1 of 1) K10841 - DNA excision repair protein ERCC-6 (ERCC6, CSB, RAD26); SNF2-related DNA/RNA helicase | 5'UTR |
Cre06.g270900 | SUV3 | Mitochondrial DEAD-box DNA/RNA helicase; (1 of 1) K17675 - ATP-dependent RNA helicase SUPV3L1/SUV3 [EC:3.6.4.13] (SUPV3L1, SUV3) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTAGCCCCTAGTGTTAGAACAATACTGGGCAACTAGTACTTTGGAAG |
Internal bar code: | GACTACTGGGACCAATAGAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1989 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTACTGCTAATGCGTGTGC |
Suggested primer 2: | AACTTCCTTGCCGTAGCCTC |