| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.060003 |
| Chromosome: | chromosome 12 |
| Location: | 2090012 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510250 | VTC1 | Vacuolar Transport Chaperone-like protein; (1 of 6) PTHR10783 - XENOTROPIC AND POLYTROPIC RETROVIRUS RECEPTOR 1-RELATED | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCACGGAGCATCGCTGCATGCTTAGAAAAGGTAGTCAATGACGGCGA |
| Internal bar code: | TTCAAAAATCCACGCGACTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1270 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCTCCCGATACCACTGTA |
| Suggested primer 2: | TTCCCACACGTCAAACACCA |