| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060081 |
| Chromosome: | chromosome 3 |
| Location: | 3966829 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g171300 | GYX1 | (1 of 1) 1.1.3.15 - (S)-2-hydroxy-acid oxidase / Hydroxy-acid oxidase B; Glycolate oxidase | 3'UTR |
| Cre03.g171350 | SEC61A | SEC61-alpha subunit of ER-translocon; (1 of 1) K10956 - protein transport protein SEC61 subunit alpha (SEC61A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACAATACGTCGGCAAGTACTCGCAGCAGGAGCTCACACTGGCCTTCGT |
| Internal bar code: | TACAAGATACCTCCGTGTCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3621 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTGCAGCTGTGTGACAC |
| Suggested primer 2: | TGACGTCTGTCCCTCGTTTG |