| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.060306 |
| Chromosome: | chromosome 6 |
| Location: | 4714694 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279150 | TSD2 | (1 of 2) 6.1.1.12 - Aspartate--tRNA ligase / Aspartyl-tRNA synthetase; Aspartyl-tRNA synthetase | 3'UTR |
| Cre06.g279183 | GEX150 | (1 of 1) PF09808 - Small nuclear RNA activating complex (SNAPc), subunit SNAP43 (SNAPc_SNAP43) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCACGTGATTTTAATTTCAGCGAAAGAGCCGCAGCCGGCTGATGCC |
| Internal bar code: | CTTACAGAGTAGGCCGACAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1411 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCTTTGCCGCAGTGAAA |
| Suggested primer 2: | CCAACAGGTCGCAACACTTG |