| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060329 |
| Chromosome: | chromosome 10 |
| Location: | 1302180 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427150 | SPL16 | (1 of 1) K12870 - pre-mRNA-splicing factor ISY1 (ISY1); Pre-mRNA splicing factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCCGTATTGTTGCTTTTGGTCTGAAGTTGCAAAGCTTCTCCGCTGAT |
| Internal bar code: | GCCACAATGTTCCGGTGATAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2443 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGCGCATGAGTTCACGTC |
| Suggested primer 2: | CAGCTCCTTCCACTCCCTTG |