Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060835 |
Chromosome: | chromosome 17 |
Location: | 5754744 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g740950 | LHL4,ELIP6,ELI6 | (1 of 12) IPR022796//IPR023329 - Chlorophyll A-B binding protein // Chlorophyll a/b binding protein domain; LHC-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAAGCCAGACATGGGGCCCAGGATGCCAGACCACTTCAGATAGGTGAT |
Internal bar code: | ATTATTACTTAGGCCTACGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4822 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTGTGTTAGGGGAGGTTT |
Suggested primer 2: | CTCACACGCAAAACCACCTG |