| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.061542 |
| Chromosome: | chromosome 1 |
| Location: | 4513409 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030850 | POA4 | 20S proteasome alpha subunit D; (1 of 1) K02731 - 20S proteasome subunit alpha 4 (PSMA7) | 3'UTR |
| Cre01.g030900 | (1 of 1) 6.2.1.26 - o-succinylbenzoate--CoA ligase / OSB-CoA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTAGGAAAGGGGATTTGTATCCGTGCCCATGTAACTCTCGGATGACT |
| Internal bar code: | TTCACTAGTAGGCTTGGTCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5012 |
| LEAP-Seq percent confirming: | 81.4159 |
| LEAP-Seq n confirming: | 92 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCTTGCCTAGCTCAGAC |
| Suggested primer 2: | GGTTAAGACTGGTCCACGGG |