| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061710 |
| Chromosome: | chromosome 12 |
| Location: | 6987494 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560900 | CPLD35,AOF7 | Flavin-containing amine oxidase. Conserved in plant lineage and Diatoms; (1 of 2) 1.3.5.5 - 15-cis-phytoene desaturase / Plant-type phytoene desaturase | 5'UTR |
| Cre12.g560902 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTGAAATGAATTGCTTCCGGAGCCAGATAACGTCGCCTCCCTTCTCGC |
| Internal bar code: | AGTCATATCTCTCTGTTAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5725 |
| LEAP-Seq percent confirming: | 98.3425 |
| LEAP-Seq n confirming: | 178 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 181 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCGAGTTAGGGTGTTGCC |
| Suggested primer 2: | CCGTCCACCTTATCCGTACG |