| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061984 |
| Chromosome: | chromosome 12 |
| Location: | 5411663 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529350 | SMM42 | (1 of 1) 2.1.1.163//2.1.1.201 - Demethylmenaquinone methyltransferase / Demethylmenaquinone C-methylase // 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase; S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAACAGTTGGCCGGGCGGGGGCCACGTTAACCTGCTGGCGCTGTCACG |
| Internal bar code: | GTCTTTGTGAGCAGGAGTGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4996 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGTTGACCATTGTTGCG |
| Suggested primer 2: | CCGAGACATCCTGGACATCG |