| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.062794 |
| Chromosome: | chromosome 13 |
| Location: | 3182282 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585150 | EIF6A,EIF6 | (1 of 1) K03264 - translation initiation factor 6 (EIF6); Eukaryotic translation initiation factor 6 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACTTTCTGCCTCATCCTAATTTACGGCCGCCCTCTTGCCGCCAAGCCG |
| Internal bar code: | GCACAAGAGTTTGGGAAGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2883 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCATCCAGGTCCTCGATG |
| Suggested primer 2: | TCGGTGAGTGGCCTTTCTTC |