Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.063148 |
Chromosome: | chromosome 3 |
Location: | 4888639 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g178600 | TOP1 | DNA topoisomerase I; (1 of 1) K03163 - DNA topoisomerase I [EC:5.99.1.2] (TOP1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCCGGGTTGCTTTGCCCCAACGGCTCAACCGCGGCATGTGAGTGGAC |
Internal bar code: | GTTTATAGGACTCGAAAGTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3872 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 69 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCGGTTGTACGGATAGGG |
Suggested primer 2: | TTACCTTGGTTCACTCGGCC |