| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.063815 |
| Chromosome: | chromosome 2 |
| Location: | 2006529 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088350 | SNR3 | (1 of 6) PF09335 - SNARE associated Golgi protein (SNARE_assoc); SNARE associated Golgi protein | 3'UTR |
| Cre02.g088400 | DEG1,DEG1A | (1 of 3) PTHR22939:SF81 - PROTEASE DO-LIKE 1, CHLOROPLASTIC; Deg protease | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTATACAAATACCGATCGCTACCTGTGCCACCTGCTAGCCACCTGCTTGC |
| Internal bar code: | ATCTGGACGGACCGAGGAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1888 |
| LEAP-Seq percent confirming: | 69.0476 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTCCGAGAGCAACCTTG |
| Suggested primer 2: | CTGCATTCACTCCGCATTCG |