Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.064649 |
Chromosome: | chromosome 16 |
Location: | 7556647 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683495 | REX1-S,TFB5,REX1S | (1 of 1) K10845 - TFIIH basal transcription factor complex TTD-A subunit (TTDA, GTF2H5, TFB5); TFB5 subunit of general Transcription Factor II H, involved in Nucleotide Excision Repair | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGCGCAGGAGCAGCGGCAGCGGGCAGCGAGGGGAGGAGGGGCCACAAC |
Internal bar code: | TGTAGCATAGGAGCATAACGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 538 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGACAGACAAGTGGCAGA |
Suggested primer 2: | GTATTCACGCGATTGTGCCC |