| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.065417 |
| Chromosome: | chromosome 3 |
| Location: | 6497848 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193750 | GCST,GCST1 | Glycine cleavage system, T protein; (1 of 1) K00605 - aminomethyltransferase (gcvT, AMT) | 3'UTR |
| Cre03.g193800 | TSN1 | Aspartyl-tRNA synthetase; (1 of 1) 6.1.1.22 - Asparagine--tRNA ligase / Asparaginyl-tRNA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGCGGATTACGAATGGTGGTAGTGCTGAACACAGCCCCGGCGTAACA |
| Internal bar code: | CTGATAGTCGTATAGGACACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2839 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGGACGGTTTTTGAACC |
| Suggested primer 2: | GCCGTAATACTCCATCGCCA |