| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065492 |
| Chromosome: | chromosome 2 |
| Location: | 3867444 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101400 | CHC1,NSG15 | Clathrin Heavy Chain; (1 of 1) K04646 - clathrin heavy chain (CLTC) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTCATATCTTGGTGGTAAACTTATCCGCAGGGCCGTGTGGGCCAACG |
| Internal bar code: | AGCGAAGTTGATTATGAAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4973 |
| LEAP-Seq percent confirming: | 97.9592 |
| LEAP-Seq n confirming: | 96 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGGCTCTGAGTCAAAGGT |
| Suggested primer 2: | CTCCACCAGGGCTGCAATAA |