| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.065708 |
| Chromosome: | chromosome 12 |
| Location: | 1478349 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488100 | UPF3 | (1 of 1) K14328 - regulator of nonsense transcripts 3 (UPF3, RENT3); UPF3 regulator of nonsense transcripts, NMD protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACGCTTGGAAGAAAATTGTGAGCATGAGCATTTACATGGCGTCGGAG |
| Internal bar code: | ACCCAAGTAGCCGGCGCAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3940 |
| LEAP-Seq percent confirming: | 79.7297 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTCTGGAGGATGCCCTT |
| Suggested primer 2: | ATTGATGTAGGCGCGAGAGG |