Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.065716 |
Chromosome: | chromosome 3 |
Location: | 4151552 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g172950 | PUS1,PUS21,CBF5 | TruB family RNA pseudouridine synthase; (1 of 1) K11131 - H/ACA ribonucleoprotein complex subunit 4 (DKC1, NOLA4, CBF5) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCCGAACCACCTAGCAAGGCCAGATCGCTCATGCGCTAACAGGCTAT |
Internal bar code: | GGTAGTTGGCTCATTTGCCTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3888 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGAGACCGTGTTTCCCGT |
Suggested primer 2: | CTATGTCTTGCAGCGCGTTC |