Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.065769 |
Chromosome: | chromosome 16 |
Location: | 397345 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g693700 | UBC9 | Ubiquitin-conjugating enzyme E2; (1 of 2) K06689 - ubiquitin-conjugating enzyme E2 D/E (UBE2D_E, UBC4, UBC5) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAGTCTCTTCTTCCGCCGCACTTCCAACACTGTATACATACGCTTGGG |
Internal bar code: | GATGGATAAATGACGTACTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4772 |
LEAP-Seq percent confirming: | 97.2603 |
LEAP-Seq n confirming: | 71 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCTGTTGAGCGGATGACA |
Suggested primer 2: | GGGGTTCGACATCACCTTGT |