Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.065843 |
Chromosome: | chromosome 2 |
Location: | 6435071 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g388400 | RAT1 | (1 of 1) PF07798 - Protein of unknown function (DUF1640) (DUF1640); Chloroplast tscA maturation factor | 3'UTR |
Cre09.g388450 | ELG29 | Exostosin-like glycosyltransferase 29; (1 of 2) PTHR31389:SF4 - PROTEIN F32B4.1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGGCAACTGTGGCCGACCCCCTCCCACGGCCCGCCCCCAGCCACAT |
Internal bar code: | TGCGTGGTATGGAACGGGCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2163 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAACGACACGGTGAGTCAC |
Suggested primer 2: | TGGCTGGCGAATTGTTTGTG |