| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.066480 |
| Chromosome: | chromosome 12 |
| Location: | 1481107 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488050 | FFT5 | putative fructan fructosyltransferase; (1 of 1) 2.4.1.99//3.2.1.26 - Sucrose:sucrose fructosyltransferase / Sucrose:sucrose 1-fructosyltransferase // Beta-fructofuranosidase / Saccharase | 3'UTR |
| Cre12.g488100 | UPF3 | (1 of 1) K14328 - regulator of nonsense transcripts 3 (UPF3, RENT3); UPF3 regulator of nonsense transcripts, NMD protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGGCTTCAGGAGCGTCTACTTGGGAGCGATGAGCAGTTGTGCTGAGTG |
| Internal bar code: | GGGAACCTCGCTGTAGGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1579 |
| LEAP-Seq percent confirming: | 88.3721 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTTCGATGCTCTTCGCG |
| Suggested primer 2: | AATACACACAGGCAGCACCA |