Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.066988 |
Chromosome: | chromosome 3 |
Location: | 4637251 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g176930 | (1 of 4) PF03134 - TB2/DP1, HVA22 family (TB2_DP1_HVA22) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGTCATGTGTTTGTAACAACATAGGCAACTGCTGCACAGAACGCCT |
Internal bar code: | TTCCCAGCAAGTTCAGCTAAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 713 |
LEAP-Seq percent confirming: | 16.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGAAGCGCATGCAAGCTAG |
Suggested primer 2: | GGTGCCCGCATGATCTATGA |